منابع مشابه
1′,5-Dinitro-2′-phenyl-2′,3′,5′,6′,7′,7a’-hexahydrospiro[indoline-3,3′-1′H-pyrrolizin]-2-one
In the title cyclo-adduct, C(20)H(18)N(4)O(5), the rings of the pyrrolizine system adopt envelope conformations. A centrosymmetric dimer is formed via inter-molecular N-H⋯O hydrogen bonds between the indolinone rings.
متن کامل3-Cyclohexylsulfanyl-2-(4-methylphenyl)-5,7-dinitro-1H-indole
In the title compound, C(21)H(21)N(3)O(4)S, the cyclo-hexane ring adopts a chair conformation. The nitro and methyl-phenyl groups are all coplanar with the indole ring system. Intra-molecular N-H⋯O and C-H⋯S hydrogen bonds generate S(6) ring motifs. The mol-ecules form R(2) (2)(20) centrosymmetric dimers via inter-molecular C-H⋯O hydrogen bonds. A short O⋯O contact [2.842 (2) Å] is observed in ...
متن کاملSome observations on the toxic properties of 3:5-dinitro-ortho-cresol.
This paper records experimental work with animals on the toxicity and mode of action of dinitro-ortho-cresol (DNOC or DNC), a compound widely used in agriculture, and occasionally responsible for the death of men handling it in the field. Most of the data on the toxicity of the related compound dinitro-phenol (DNP) was published in the decade after the 1914-18 war. During that war DNP had been ...
متن کامل2 ‐ SIM 3 : Fw : 5 ’ ‐ GCCTGCAGCTGAGATGCGGCAGAAGCCGGGGACAGTGATGATGAGG ‐ 3 ’ Rv : 5 ’ ‐ CCTCATCATCACTGTCCCCGGCTTCTGCCGCATCTCAGCTGCAGGC
U2OS and U2OS‐HIS‐SUMO2 cell lines [1] were grown in DMEM supplemented with 10% FCS and penicillin/streptomycin (Life Technologies). SLX4+/+ MEFs and SLX4‐/‐ MEFs [2] were also supplemented with non‐essential AAs. Every cell line was checked for mycoplasma contamination regularly. The result was always negative. mSLX4 was amplified by PCR from pBABE‐mSLX4 [2] and cloned into pDONR207 using a BP...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Chemical and Pharmaceutical Bulletin
سال: 1958
ISSN: 0009-2363,1347-5223
DOI: 10.1248/cpb.6.442