Uber das 3, 5-Dinitro-2-pyridon.

نویسندگان
چکیده

برای دانلود باید عضویت طلایی داشته باشید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

1′,5-Dinitro-2′-phenyl-2′,3′,5′,6′,7′,7a’-hexa­hydro­spiro­[indoline-3,3′-1′H-pyrrolizin]-2-one

In the title cyclo-adduct, C(20)H(18)N(4)O(5), the rings of the pyrrolizine system adopt envelope conformations. A centrosymmetric dimer is formed via inter-molecular N-H⋯O hydrogen bonds between the indolinone rings.

متن کامل

3-Cyclo­hexyl­sulfan­yl-2-(4-methyl­phen­yl)-5,7-dinitro-1H-indole

In the title compound, C(21)H(21)N(3)O(4)S, the cyclo-hexane ring adopts a chair conformation. The nitro and methyl-phenyl groups are all coplanar with the indole ring system. Intra-molecular N-H⋯O and C-H⋯S hydrogen bonds generate S(6) ring motifs. The mol-ecules form R(2) (2)(20) centrosymmetric dimers via inter-molecular C-H⋯O hydrogen bonds. A short O⋯O contact [2.842 (2) Å] is observed in ...

متن کامل

Some observations on the toxic properties of 3:5-dinitro-ortho-cresol.

This paper records experimental work with animals on the toxicity and mode of action of dinitro-ortho-cresol (DNOC or DNC), a compound widely used in agriculture, and occasionally responsible for the death of men handling it in the field. Most of the data on the toxicity of the related compound dinitro-phenol (DNP) was published in the decade after the 1914-18 war. During that war DNP had been ...

متن کامل

2 ‐ SIM 3 : Fw : 5 ’ ‐ GCCTGCAGCTGAGATGCGGCAGAAGCCGGGGACAGTGATGATGAGG ‐ 3 ’ Rv : 5 ’ ‐ CCTCATCATCACTGTCCCCGGCTTCTGCCGCATCTCAGCTGCAGGC

U2OS and U2OS‐HIS‐SUMO2 cell lines [1] were grown in DMEM supplemented with 10% FCS and penicillin/streptomycin (Life Technologies). SLX4+/+ MEFs and SLX4‐/‐ MEFs [2] were also supplemented with non‐essential AAs. Every cell line was checked for mycoplasma contamination regularly. The result was always negative. mSLX4 was amplified by PCR from pBABE‐mSLX4 [2] and cloned into pDONR207 using a BP...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Chemical and Pharmaceutical Bulletin

سال: 1958

ISSN: 0009-2363,1347-5223

DOI: 10.1248/cpb.6.442